Population Data on the STR Loci D7S820, D8S1179, and D12S391 in a Sample Population of Rio De Janeiro, Brazil

By Gomes, Giselle G.; Marsillac, Sylvia M. et al. | Forensic Science Communications, January 2003 | Go to article overview

Population Data on the STR Loci D7S820, D8S1179, and D12S391 in a Sample Population of Rio De Janeiro, Brazil


Gomes, Giselle G., Marsillac, Sylvia M., Moura-Neto, Rodrigo S., Silva, Rosane, Forensic Science Communications


Abstract

Allelic distribution for three tetrameric short tandem repeat (STR) loci, D7S820, D8S1179, and D12S391, were determined in a Rio de Janeiro, Brazil, sample population. There were no detectable departures from Hardy-Weinberg expectations in any of the three loci, and there was little evidence for associations of alleles between loci in the database. Departures from expectation of independence were observed at D8S1179/D12S391 (p=0,0488).

Introduction

Brazil was colonized by the Portuguese at the beginning of the 16th century. Until the end of the 19th century, an official government population survey indicated that the people were miscegeneous: 44 percent Caucasians, 14.6 percent African descendants, and 41.4 percent mulattos (IBGE 2000). After that, other ethnogeographic populations migrated to Brazil from Europe, mainly Spain, Italy, and Germany, and from Japan. Due to highly ethnical miscegenation, it is difficult to identify and study the genetic composition of any given group. Using restricted fragment length polymorphorism genotyping of nine variable number tandem repeat loci, previous work (Moura-Neto and Budowle 1997; Silva and Moura-Neto 1998) had shown no detectable population substructure in a Rio de Janeiro sample population, when compared to United States ethnic groups. Recently, using Y-chromosome single-nucleotide polymorphism haplotyping, it has been demonstrated that the majority of the paternal lineages of Brazilian population descendants originated from Europe (Carvalho-Silva et al. 2001). Also, Y-chromosome STR haplotyping of a Rio de Janeiro sample population has shown a haplotype primarily found in the Europeanlike profile (Costa et al. 2002). Rio de Janeiro is the most representative site of the "melting pot" of Brazilian culture. The aim of this work is to introduce new data about three commonly used STRs in a sample population of Rio de Janeiro, Brazil, that can be used in match probabilities calculations, substructure population analysis, and genetic distance.

Materials and Methods

Samples and DNA Extraction

DNA samples were extracted from peripheral blood samples from 97 unrelated individuals from Rio de Janeiro's population. The considered population structure for Rio de Janeiro is comprised of European-derived Brazilians. African-derived and native Brazilian descendants have been excluded. For this study DNA was extracted according to Miller et al. (1988).

PCR Amplification

PCR amplification for the loci D7S820 (GenBank: G08616), D8S1179 (GenBank: G08710), and D12S391 (GenBank: G08921) was carried out as described with minor modifications.

* Initial denaturation of 5 minutes at 92[degrees]C

* 27 cycles of 30 seconds at 94[degrees]C

* 75 seconds at 55[degrees]C

* 15 seconds at 72[degrees]C

* Final extension step of 6 minutes at 72[degrees]C

In a volume of 25 ml, 200mM of dNTPs; 50ng of genomic DNA; 1,5U of Taq DNA polymerase; 10 mM Tris-HCl pH 8.3; 1,5mM of MgCl2 ; 50 mM KCl and 1uM of the primers as listed.

* D8S1179, F: 5'TTTTTGTATTTCATGTGT ACATTCG3', R: 5'CGTAGCTATAATTAGTTCATTTTCA3'

* D7S820, F: 5'TGTCATAGTTTAGAACGAACTAACG3', R: 5'CTGAG GTATCAAAAACTCAGAGG3'

* D12S391, F: 5'CCAGAGAGAAAGAATCAACA3', R:5'TGCCTT TTAGACCTGGACTG3'

STR Typing and Sequencing

Different allele sizes were determined through the analysis of PCR product on 6 percent denaturing polyacrylamide gel electrophoresis and visualized with silver nitrate staining. Alleles under homozygous suspicion, after the amplification, were sequenced by dideoxy termination using the Big Dye Terminator Cycle Sequence in an ABI Prism[R] 3100 Genetic Analyzer with separation medium POP-6[TM](Applied Biosystems, Foster City, California).

Statistical Analysis

Frequency of alleles, Hardy-Weinberg equilibrium, and other population parameters were calculated using Genetic Data Analysis Software V1-d16 (Lewis and Zaykin 2001). …

The rest of this article is only available to active members of Questia

Sign up now for a free, 1-day trial and receive full access to:

  • Questia's entire collection
  • Automatic bibliography creation
  • More helpful research tools like notes, citations, and highlights
  • Ad-free environment

Already a member? Log in now.

Notes for this article

Add a new note
If you are trying to select text to create highlights or citations, remember that you must now click or tap on the first word, and then click or tap on the last word.
One moment ...
Default project is now your active project.
Project items

Items saved from this article

This article has been saved
Highlights (0)
Some of your highlights are legacy items.

Highlights saved before July 30, 2012 will not be displayed on their respective source pages.

You can easily re-create the highlights by opening the book page or article, selecting the text, and clicking “Highlight.”

Citations (0)
Some of your citations are legacy items.

Any citation created before July 30, 2012 will labeled as a “Cited page.” New citations will be saved as cited passages, pages or articles.

We also added the ability to view new citations from your projects or the book or article where you created them.

Notes (0)
Bookmarks (0)

You have no saved items from this article

Project items include:
  • Saved book/article
  • Highlights
  • Quotes/citations
  • Notes
  • Bookmarks
Notes
Cite this article

Cited article

Style
Citations are available only to our active members.
Sign up now to cite pages or passages in MLA, APA and Chicago citation styles.

(Einhorn, 1992, p. 25)

(Einhorn 25)

1

1. Lois J. Einhorn, Abraham Lincoln, the Orator: Penetrating the Lincoln Legend (Westport, CT: Greenwood Press, 1992), 25, http://www.questia.com/read/27419298.

Cited article

Population Data on the STR Loci D7S820, D8S1179, and D12S391 in a Sample Population of Rio De Janeiro, Brazil
Settings

Settings

Typeface
Text size Smaller Larger Reset View mode
Search within

Search within this article

Look up

Look up a word

  • Dictionary
  • Thesaurus
Please submit a word or phrase above.
Print this page

Print this page

Why can't I print more than one page at a time?

Full screen

matching results for page

Cited passage

Style
Citations are available only to our active members.
Sign up now to cite pages or passages in MLA, APA and Chicago citation styles.

"Portraying himself as an honest, ordinary person helped Lincoln identify with his audiences." (Einhorn, 1992, p. 25).

"Portraying himself as an honest, ordinary person helped Lincoln identify with his audiences." (Einhorn 25)

"Portraying himself as an honest, ordinary person helped Lincoln identify with his audiences."1

1. Lois J. Einhorn, Abraham Lincoln, the Orator: Penetrating the Lincoln Legend (Westport, CT: Greenwood Press, 1992), 25, http://www.questia.com/read/27419298.

Cited passage

Thanks for trying Questia!

Please continue trying out our research tools, but please note, full functionality is available only to our active members.

Your work will be lost once you leave this Web page.

For full access in an ad-free environment, sign up now for a FREE, 1-day trial.

Already a member? Log in now.