Academic journal article Iranian Journal of Public Health

CDC42-Interacting Protein 4 Gene Is Down Trans-Regulated by HBV DNA Polymerase Trans Activated Protein 1

Academic journal article Iranian Journal of Public Health

CDC42-Interacting Protein 4 Gene Is Down Trans-Regulated by HBV DNA Polymerase Trans Activated Protein 1

Article excerpt

Itroduction

It is well known that after the infection of HBV into the target cells, the interaction of the virus genome and proteins with genes and proteins in target cells plays important roles in determining HBV replication, immune evasion, and chronic infection (1). In recent years, it has been found that complex trans-regulation mechanism is in- volved in the interaction of HBV with target cells and the HBV proteins play a trans-regulative role in gene expression in target cells (2). The critical antigen components of HBV associated with trans-regulation function have been found in tar- get cells and the specific mechanisms have been clarified, which are of great significance in confirming the pathogenic mechanisms of HBV and discovering effective prevention and treat- ment methods. HBV DNA polymerase transac- tivated protein 1 (HBVDNAPTP1) is a protein that is worth studying. Thus, suppression subtrac- tive hybridization technolog y (GenBank accession no. AY450389) has been used to study the trans- regulatory target genes of the HBV DNA polymerase, which was verified by dot blot hybridization. The HepG2 hepatoblastoma cell line was screened to obtain a novel gene (Gen- Bank accession no. AY450389), which was located on the long arm of chromosome 9, region 2, band 2, sub-band 31 (9q22.31). Using Unigene database for expression analysis of tissue distribution, this gene is expressed in a variety of tissues but not in pituitary gland, tonsil, tongue, thymus, trachea and umbilical cord. A preliminary study clarified that HBVDNAPTP1 is localized in the cytoplasm (3). In the present study, we first analyzed the expres- sion of HBVDNAPTP1 in THP-1 cells and subsequently screened genes transactivated by HBVDNAPTP1 using suppression subtractive hybridization (SSH). SSH was designed to gener- ate a cDNA library which is enriched in differen- tially expressed sequences and, more importantly, equalized for the number of individual cDNA species, thus allowing the detection of rare tran- scripts (4). The full-length gene from the library was searched for homologs in GenBank. Finally, the relationship of the CIP4 and the HBVDN- APTP1 was discussed.

Materials and Methods

Construction of vectors

For construction of eukaryotic expression vector pcDNA3.1 (-)/myc-His A-HBVDNAPTP1, the HB- VDNAPTP1 fragment was PCR-amplified with the forward primer (5'- GGATCCATGATGTTTGTGCT- GCTAAAC), containing an BamHI site and reverse primer (5'- AAGCTTATAAGTCCTCTCTAAAATTGC), containing a HindIII site. The fragment was in- serted into the cloning vector pGEM-T (Promega), resulting in pGEM-T-HBVDNAPTP1. An BamHI-HindIII fragment was isolated from the vector and inserted into BamHI and HindIII digested pcDNA3.1 (-)/myc-His A (Invitrogen), giving pcDNA3.1 (-)/myc-His A-HBVDNAPTP1. The vector was sequenced and digested with corresponding restriction enzymes to confirm the sequence accuracy.

Cell culture and transient transfection

THP-1 cells were cultivated in Dulbecco's modi- fied Eagle's medium (DMEM, Invitrogen) containing 100 IU of penicillin and 100 µg of streptomycin per mL, supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS, Hyclone), at 37 °C in a 5% CO2 and 90% relative humidity. The cells were seeded out the day prior to transfection at a density of 8×105 cells per 35 mm dish and reached 50% confluence at the time of transfection. All transfections were performed with FuGENE6 Transfection Reagent (Roche) according to the manufacturer's instructions. The medium was changed 5 h after transfection and cells were harvested 40-48 h after transfection. All transfections and assays were repeated inde- pendently three times in triplicate.

Detection of HBVDNAPTP1 expression

mRNA from THP-1 cells transfected with pcDNA3.1 (-)/myc-His A-HBVDNAPTP1 and pcDNA3.1(-)/myc-His A was isolated using a mi- cro mRNA purification kit (Amersham Biosci- ences), and cDNAs were reverse-transcribed from the mRNA. …

Search by... Author
Show... All Results Primary Sources Peer-reviewed

Oops!

An unknown error has occurred. Please click the button below to reload the page. If the problem persists, please try again in a little while.