Academic journal article Iranian Journal of Public Health

Nested-Pcr as Gene-Mapping Tool to Recognize Length of Integron Class I among P.aeruginosa

Academic journal article Iranian Journal of Public Health

Nested-Pcr as Gene-Mapping Tool to Recognize Length of Integron Class I among P.aeruginosa

Article excerpt

Background: Integron as mobile elements could be help to induce resistance among species of bacteria. Three class of Integron is known and among them Integron class I by high frequency among P.aeruginosa play mainly role to resistant to antibiotics. Molecular detection of the resistance genes car- ried by Pseudomonas aeruginosa is important in assessing spread and colonization and in treatment of infections. This study designed to detect whole consequence of Integron class I among isolated P.aerugionsa from urine samples.

Methods: P.aeruginosa strains isolated form Urine samples and screened for Integron class I presence by PCR for intl1 gene. Length of integron class I were recognized by Nested- PCR for intl1-f (CAGTGGACATAAGCCTGT), qacEΔ1- (TGAGCCCCATACCTACAAAGC) and sul1-R (GTTTCCGAGAAGGTGATTGCG). First PCR done by intl1 F and sul 1 R and its product used for next PCR (intl1 F and qacEΔ1 R).

Results: Among 61 isolated P.aeruginosa, 46 detected as Integron class I positive and 6 isolates were blaVIM positive. …

Search by... Author
Show... All Results Primary Sources Peer-reviewed

Oops!

An unknown error has occurred. Please click the button below to reload the page. If the problem persists, please try again in a little while.